Bacillus sp. YP1: QF06_06985 Help Entry QF06_06985        CDS       T03701                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bacy  Bacillus sp. YP1 Pathway bacy00998   Biosynthesis of various antibiotics bacy01100   Metabolic pathways bacy01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bacy00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     QF06_06985    00074 Mycolic acid biosynthesis     QF06_06985   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     QF06_06985 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  AJO58213 LinkDB All DBs Position 1404887..1405120 Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagacacattagagcgtgtaacgaaaatcatcgtagatcgccttggcgttgatgaa gcagacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggagatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system