Bacillus aerius: RE735_11880 Help Entry RE735_11880       CDS       T09365                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism baei  Bacillus aerius Pathway baei00998   Biosynthesis of various antibiotics baei01100   Metabolic pathways baei01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:baei00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     RE735_11880 (acpP)    00074 Mycolic acid biosynthesis     RE735_11880 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     RE735_11880 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  WMT27834 LinkDB All DBs Position complement(2207951..2208184) Genome browser AA seq 77 aa AA seqDB search MADVLERVSKIIVDRLGVDEADVKMEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYINSQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagacgtattagagcgtgtatcaaaaattattgtagaccgccttggcgttgatgag gctgacgtgaaaatggaagcttcatttaaagaagatttaggcgctgattcccttgatgta gttgagctagttatggaacttgaagatgagttcgatatggaaatttctgacgaagatgct gaaaaaattgcaacagtcggtgacgctgtgaactacataaatagccagcaataa

DBGET integrated database retrieval system