Heyndrickxia coagulans 36D1: Bcoa_0088 Help Entry Bcoa_0088         CDS       T01628                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bag  Heyndrickxia coagulans 36D1 Pathway bag01100   Metabolic pathways bag01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bag00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Bcoa_0088    00074 Mycolic acid biosynthesis     Bcoa_0088   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Bcoa_0088 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Ribosomal_L50 Ribosomal_L12_N Motif Other DBs NCBI-ProteinID:  AEO99313 UniProt:  G2TJP2 LinkDB All DBs Position complement(83977..84210) Genome browser AA seq 77 aa AA seqDB search MADVLERVTKIIVDRLGVEESKVTLEAKFKEDLGADSLDVVELVMELEDEFGMEISDEDA EKIVTVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagacgtattagagcgtgtgacaaagatcatcgttgaccgccttggtgtcgaagaa tccaaagttacactggaagcgaaattcaaagaagatcttggcgctgattcccttgatgta gtggaattggtgatggaattggaagatgaattcggaatggaaatttctgacgaggatgct gagaaaattgtaacagtgggtgacgctgtaaattacatacaaaatcagcagtaa

DBGET integrated database retrieval system