Baekduia alba: DSM104299_02458 Help Entry DSM104299_02458   CDS       T09120                                  Symbol acpP Name (GenBank) Acyl carrier protein   KO K02078   acyl carrier protein Organism bala  Baekduia alba Pathway bala01100   Metabolic pathways bala01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bala00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     DSM104299_02458 (acpP)    00074 Mycolic acid biosynthesis     DSM104299_02458 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     DSM104299_02458 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF6738 Motif Other DBs NCBI-ProteinID:  WCB93742 LinkDB All DBs Position 2456059..2456310 Genome browser AA seq 83 aa AA seqDB search MTREDVFTLIRNHLADELDVDGTRIDESTRFKEDLDADSLDLYTLVQELEDSYGVKMSDE QAAQILSVGQAVDFVLAHAPSAT NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atgacccgcgaagacgtcttcaccctgatccggaaccacctcgccgacgagctcgacgtc gatgggacgcggatcgacgagtcgacgcgcttcaaggaggatctggacgccgactcgctg gatctgtacacgctggtgcaggagctcgaagactcctacggcgtgaagatgtcggacgag caggcggcgcagatcctctccgtgggccaggcggtcgacttcgtcctcgcccacgcgccc agcgccacgtag

DBGET integrated database retrieval system