Bacillus velezensis NAU-B3: BAPNAU_2176 Help Entry BAPNAU_2176       CDS       T02859                                  Symbol acpP3 Name (GenBank) Acyl carrier protein ACP   KO K02078   acyl carrier protein Organism bamb  Bacillus velezensis NAU-B3 Pathway bamb00998   Biosynthesis of various antibiotics bamb01100   Metabolic pathways bamb01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bamb00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     BAPNAU_2176 (acpP3)    00074 Mycolic acid biosynthesis     BAPNAU_2176 (acpP3)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     BAPNAU_2176 (acpP3) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  CDH95956 LinkDB All DBs Position complement(2351482..2351715) Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagatacattagagcgtgtaacgaaaatcatcgtagaccgccttggcgttgatgaa gctgacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggagatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system