Bacillus amyloliquefaciens LFB112: U722_08355 Help Entry U722_08355        CDS       T02965                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bamf  Bacillus amyloliquefaciens LFB112 Pathway bamf00998   Biosynthesis of various antibiotics bamf01100   Metabolic pathways bamf01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bamf00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     U722_08355    00074 Mycolic acid biosynthesis     U722_08355   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     U722_08355 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  AHC42121 LinkDB All DBs Position 1624532..1624765 Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagatacattagagcgtgtaacgaaaatcatcgtagaccgccttggcgttgatgaa gctgacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggagatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system