Bacillus velezensis TrigoCor1448: AJ82_09010 Help Entry AJ82_09010        CDS       T03161                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bamt  Bacillus velezensis TrigoCor1448 Pathway bamt00998   Biosynthesis of various antibiotics bamt01100   Metabolic pathways bamt01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bamt00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     AJ82_09010   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     AJ82_09010 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Guanylate_cyc DUF1493 HLH Motif Other DBs NCBI-ProteinID:  AHK49130 LinkDB All DBs Position 1620167..1620400 Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagatacattagagcgtgtaacgaaaatcatcgtagaccgccttggcgttgatgaa gctgacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggagatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system