Bacillus velezensis CAU B946: BACAU_1546 Help Entry BACAU_1546        CDS       T01692                                  Symbol acpP Name (GenBank) Acyl carrier protein ACP   KO K02078   acyl carrier protein Organism baq  Bacillus velezensis CAU B946 Pathway baq00998   Biosynthesis of various antibiotics baq01100   Metabolic pathways baq01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:baq00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     BACAU_1546 (acpP)    00074 Mycolic acid biosynthesis     BACAU_1546 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     BACAU_1546 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  CCF05080 LinkDB All DBs Position 1632558..1632791 Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagatacattagagcgtgtaacgaaaatcatcgtagaccgccttggcgttgatgaa gctgacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggagatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system