Bacillus velezensis FZB42: RBAM_015750 Help Entry RBAM_015750       CDS       T00582                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bay  Bacillus velezensis FZB42 Pathway bay00998   Biosynthesis of various antibiotics bay01100   Metabolic pathways bay01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bay00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     RBAM_015750 (acpP)    00074 Mycolic acid biosynthesis     RBAM_015750 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     RBAM_015750 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  ABS73938 UniProt:  A7Z4L2 LinkDB All DBs Position 1580413..1580646 Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagatacattagagcgtgtaacgaaaatcatcgtagaccgccttggcgttgatgaa gctgacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggagatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system