Burkholderiales bacterium GJ-E10: E1O_08120 Help Entry E1O_08120         CDS       T03654                                  Name (GenBank) uncharacterized protein   KO K02078   acyl carrier protein Organism bbag  Burkholderiales bacterium GJ-E10 Pathway bbag01100   Metabolic pathways bbag01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bbag00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     E1O_08120    00074 Mycolic acid biosynthesis     E1O_08120   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     E1O_08120 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  BAP87943 LinkDB All DBs Position 878814..879077 Genome browser AA seq 87 aa AA seqDB search MDLDVRVIESLESALHIPLDRSRIRPETPLMGAIPEFDSMAAVALLTTLEERFGFTIADD EFDGATFATFGSLNAFVQGKLDALSRG NT seq 264 nt NT seq  +upstreamnt  +downstreamnt ttggacctcgacgtgcgcgtgatcgaatcgctggaatcggccctgcacatcccgctggac cgaagccggatccgcccggaaaccccgttgatgggggcgattccggaattcgactcgatg gccgcggtcgccctgctcaccacgctggaagagcgattcgggttcaccatcgcggacgat gagttcgatggcgcgacgttcgcgaccttcggcagcctcaacgccttcgtgcaggggaaa ctcgacgccctttcgcgcggttag

DBGET integrated database retrieval system