Bufo bufo (common toad): 120980856 Help Entry 120980856         CDS       T07950                                  Name (RefSeq) putative metallothionein MT1DP   KO K14739   metallothionein 1/2 Organism bbuf  Bufo bufo (common toad) Brite KEGG Orthology (KO) [BR:bbuf00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:bbuf03019]     120980856    03029 Mitochondrial biogenesis [BR:bbuf03029]     120980856 Messenger RNA biogenesis [BR:bbuf03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      120980856 Mitochondrial biogenesis [BR:bbuf03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     120980856 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  120980856 NCBI-ProteinID:  XP_040266132 LinkDB All DBs Position 10:104995218..104997136 Genome browser AA seq 63 aa AA seqDB search MDPNTCNCAEGGSCTCGDSCKCKDCKCKSCKKSCCSCCPPDCSKCSQGCECATKGCESCS CCK NT seq 192 nt NT seq  +upstreamnt  +downstreamnt atggatccaaatacttgcaactgtgccgaaggtggttcctgcacctgtggggattcctgc aagtgtaaagactgcaaatgcaagtcgtgcaagaaaagttgctgctcttgctgtccacca gattgcagtaaatgcagccagggctgcgaatgtgcgactaaaggatgcgagtcctgcagc tgctgcaagtga

DBGET integrated database retrieval system