Brevundimonas bullata: U0030_16755 Help Entry U0030_16755       CDS       T10190                                  Name (GenBank) ACT domain-containing protein   KO K11258   acetolactate synthase II small subunit [EC:2.2.1.6] Organism bbul  Brevundimonas bullata Pathway bbul00290   Valine, leucine and isoleucine biosynthesis bbul00650   Butanoate metabolism bbul00660   C5-Branched dibasic acid metabolism bbul00770   Pantothenate and CoA biosynthesis bbul01100   Metabolic pathways bbul01110   Biosynthesis of secondary metabolites bbul01210   2-Oxocarboxylic acid metabolism bbul01230   Biosynthesis of amino acids Module bbul_M00019   Valine/isoleucine biosynthesis, pyruvate => valine / 2-oxobutanoate => isoleucine bbul_M00570   Isoleucine biosynthesis, threonine => 2-oxobutanoate => isoleucine Brite KEGG Orthology (KO) [BR:bbul00001]  09100 Metabolism   09101 Carbohydrate metabolism    00650 Butanoate metabolism     U0030_16755    00660 C5-Branched dibasic acid metabolism     U0030_16755   09105 Amino acid metabolism    00290 Valine, leucine and isoleucine biosynthesis     U0030_16755   09108 Metabolism of cofactors and vitamins    00770 Pantothenate and CoA biosynthesis     U0030_16755 Enzymes [BR:bbul01000]  2. Transferases   2.2  Transferring aldehyde or ketonic groups    2.2.1  Transketolases and transaldolases     2.2.1.6  acetolactate synthase      U0030_16755 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ACT_5 ACT_AHAS_ss Motif Other DBs NCBI-ProteinID:  WQE36884 LinkDB All DBs Position complement(3465356..3465607) Genome browser AA seq 83 aa AA seqDB search MSDTIHIQIDRADGSLQRLIGLVERRGFHIDGMSMADEGASRRIALTVRGRDAARSIDNL GCQIDRLFGVARIGAPAYQSEAA NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atgagcgacaccattcacatccaaatcgaccgggccgacggctcgcttcagcgtctcatc ggcctggtggagcgccgcggcttccacatcgacggcatgagcatggccgacgaaggcgcg tcgcgccgcatcgccctgaccgtgcgcggccgcgacgccgcgcgctccatcgacaacctg ggctgccagatcgaccgcctgttcggcgtcgcccgcatcggcgcccctgcctaccagtcc gaggccgcgtaa

DBGET integrated database retrieval system