Baudoinia panamericana: BAUCODRAFT_78082 Help Entry BAUCODRAFT_78082  CDS       T03106                                  Name (RefSeq) hypothetical protein   KO K10845   TFIIH basal transcription factor complex TTD-A subunit Organism bcom  Baudoinia panamericana Pathway bcom03022   Basal transcription factors bcom03420   Nucleotide excision repair Brite KEGG Orthology (KO) [BR:bcom00001]  09120 Genetic Information Processing   09121 Transcription    03022 Basal transcription factors     BAUCODRAFT_78082   09124 Replication and repair    03420 Nucleotide excision repair     BAUCODRAFT_78082  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03021 Transcription machinery [BR:bcom03021]     BAUCODRAFT_78082    03400 DNA repair and recombination proteins [BR:bcom03400]     BAUCODRAFT_78082 Transcription machinery [BR:bcom03021]  Eukaryotic type   RNA polymerase II system    Basal transcription factors     TFIIH      BAUCODRAFT_78082 DNA repair and recombination proteins [BR:bcom03400]  Eukaryotic type   SSBR (single strand breaks repair)    NER (nucleotide excision repair)     TFIIH complex      BAUCODRAFT_78082 SSDB OrthologParalogGFIT Motif Pfam:  Tfb5 Motif Other DBs NCBI-GeneID:  19117146 NCBI-ProteinID:  XP_007680490 JGI:  Bauco1_78082 UniProt:  M2M6Y6 LinkDB All DBs Position Unknown AA seq 68 aa AA seqDB search GVLVECDESIKATIVKIDAEHSHEFIIENIDDRHVLINQKKHEELKILLKEELKDTVREA EDSSTGSE NT seq 207 nt NT seq  +upstreamnt  +downstreamnt ggcgtgctcgttgagtgcgatgagtccatcaaggctacgattgttaagatcgacgctgag catagtcatgaattcattatcgagaatattgacgatcgtcatgtcttgatcaaccaaaag aagcatgaagagctcaagatcctgctcaaagaagaactcaaggacaccgttcgtgaggcc gaagacagttcgaccggctcagagtga

DBGET integrated database retrieval system