Cytobacillus dafuensis: FSZ17_09685 Help Entry FSZ17_09685       CDS       T06982                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bda  Cytobacillus dafuensis Pathway bda01100   Metabolic pathways bda01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bda00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     FSZ17_09685    00074 Mycolic acid biosynthesis     FSZ17_09685   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     FSZ17_09685 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Guanylate_cyc DUF1493 Motif Other DBs NCBI-ProteinID:  QED47503 UniProt:  A0A5B8Z5Q9 LinkDB All DBs Position 2046252..2046485 Genome browser AA seq 77 aa AA seqDB search MAEVLERVTKIIVDRLGVEESEVTLEASFKDDLGADSLDVVELVMELEDEFDMEISDDDA EKIATVGDAVTYIQAKQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagaagtattagaacgcgtaacaaagattatcgttgaccgtcttggtgttgaagag tctgaggttactctagaagcatcattcaaagatgatcttggcgctgattcccttgatgta gtagaattagttatggaattagaagatgagtttgatatggaaatttctgatgatgacgct gaaaagattgctacagtcggtgacgctgttacttacatacaagcgaagcaataa

DBGET integrated database retrieval system