Theileria equi: BEWA_054030 Help Entry BEWA_054030       CDS       T02820                                  Name (RefSeq) ubiquitin, putative   KO K13113   ubiquitin-like protein 5 Organism beq  Theileria equi Brite KEGG Orthology (KO) [BR:beq00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03041 Spliceosome [BR:beq03041]     BEWA_054030   09183 Protein families: signaling and cellular processes    04052 Cytokines and neuropeptides [BR:beq04052]     BEWA_054030 Spliceosome [BR:beq03041]  Complex B   Other components    Complex B specific factors     BEWA_054030 Cytokines and neuropeptides [BR:beq04052]  Neuropeptides   Unclassified    BEWA_054030 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ubiquitin Motif Other DBs NCBI-GeneID:  15802954 NCBI-ProteinID:  XP_004832799 UniProt:  L1LD43 LinkDB All DBs Position 4 Genome browser AA seq 42 aa AA seqDB search MAQMIEVILNDRLGRKIRVKCNSDDTILDLKKLVAAQTGKNL NT seq 129 nt NT seq  +upstreamnt  +downstreamnt atggctcagatgatcgaagtgatactaaacgaccgtttgggacggaaaatacgcgtaaag tgcaatagcgacgatacgattttggatttaaagaaacttgtcgctgctcaaactggtaag aatttgtga

DBGET integrated database retrieval system