Brachybacterium faecium: Bfae_16760 Help Entry Bfae_16760        CDS       T00965                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bfa  Brachybacterium faecium Pathway bfa01100   Metabolic pathways bfa01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bfa00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Bfae_16760    00074 Mycolic acid biosynthesis     Bfae_16760   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Bfae_16760 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Ribosomal_L50 Motif Other DBs NCBI-ProteinID:  ACU85500 UniProt:  C7MD43 LinkDB All DBs Position 1882617..1882865 Genome browser AA seq 82 aa AA seqDB search MAHTENEILEGLAEIVNEETGVATEDVKLEKSFTDDLDIDSISMMTIVVNAEEKFDVRIP DEEVKNLATVGDAVKYIEGAQN NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atggcacacaccgagaacgagatcctcgagggcctcgccgagatcgtgaacgaggagacc ggtgtcgccaccgaggacgtcaagctcgagaagtccttcaccgacgacctcgacatcgac tccatctcgatgatgaccatcgtggtcaacgccgaggagaagttcgacgtgcgcatcccc gacgaagaggtcaagaacctcgcgaccgtcggcgacgccgtcaagtacatcgagggtgct cagaactga

DBGET integrated database retrieval system