Bacteroides fragilis BOB25: VU15_20485 Help Entry VU15_20485        CDS       T03897                                  Name (GenBank) DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism bfb  Bacteroides fragilis BOB25 Brite KEGG Orthology (KO) [BR:bfb00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:bfb03032]     VU15_20485    03036 Chromosome and associated proteins [BR:bfb03036]     VU15_20485    03400 DNA repair and recombination proteins [BR:bfb03400]     VU15_20485 DNA replication proteins [BR:bfb03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     VU15_20485 Chromosome and associated proteins [BR:bfb03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     VU15_20485 DNA repair and recombination proteins [BR:bfb03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       VU15_20485 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_2 VWA_3 Motif Other DBs NCBI-ProteinID:  AKA53826 UniProt:  A0A0K6C0E1 LinkDB All DBs Position complement(4976863..4977135) Genome browser AA seq 90 aa AA seqDB search MNKAELINAMAAESGLSKVDSKKALEAFFSSVTKALSAGDKISLVGFGTFSVAERSARMG INPSTKKAIEIPAKKVAKFKPGAELTDAIK NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgaataaggctgaacttattaatgcaatggcagcggaatccggcttgagtaaagtggat tctaagaaagcgcttgaagctttcttttcttcggttacaaaagctttgtcggctggtgac aaaatttccttggttggatttggtacattctctgtagctgaaagatcagcaagaatggga atcaatccttctaccaagaaggcaattgagattcctgcaaagaaagttgctaaatttaaa ccgggtgctgagctgacagatgctataaaataa

DBGET integrated database retrieval system