Brevibacillus formosus: BP422_13475 Help Entry BP422_13475       CDS       T04939                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bfm  Brevibacillus formosus Pathway bfm00998   Biosynthesis of various antibiotics bfm01100   Metabolic pathways bfm01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bfm00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     BP422_13475    00074 Mycolic acid biosynthesis     BP422_13475   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     BP422_13475 SSDB OrthologParalogGFIT Motif Pfam:  PP-binding ACP_SdgA_C PP-binding_2 DUF1493 Motif Other DBs NCBI-ProteinID:  ASJ54478 UniProt:  A0A0H0SQV5 LinkDB All DBs Position complement(2989512..2989745) Genome browser AA seq 77 aa AA seqDB search MADTLERVKKIIVDRLGVDESKITLEASFKEDLGADSLDVVELVMELEDEFDLEISDEDA EKITSVGEVVKYIESHK NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagatactttggagcgtgtgaagaaaatcatcgtcgatcgtctgggtgtagatgag tccaaaattactttggaagcttctttcaaagaagacctgggcgctgactccctggatgtg gttgaactcgtaatggaactcgaagatgagtttgatttagagatttccgacgaagatgct gaaaagatcacttctgttggtgaggttgttaaatacatagaatctcacaagtag

DBGET integrated database retrieval system