Bordetella flabilis: BAU07_09675 Help Entry BAU07_09675       CDS       T04592                                  Name (GenBank) DNA-binding protein HU   KO K03530   DNA-binding protein HU-beta Organism bfz  Bordetella flabilis Brite KEGG Orthology (KO) [BR:bfz00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:bfz03032]     BAU07_09675    03036 Chromosome and associated proteins [BR:bfz03036]     BAU07_09675    03400 DNA repair and recombination proteins [BR:bfz03400]     BAU07_09675 DNA replication proteins [BR:bfz03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     BAU07_09675 Chromosome and associated proteins [BR:bfz03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     BAU07_09675 DNA repair and recombination proteins [BR:bfz03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       BAU07_09675 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_1 Motif Other DBs NCBI-ProteinID:  ANN77332 UniProt:  A0A193GBF2 LinkDB All DBs Position 2215718..2215990 Genome browser AA seq 90 aa AA seqDB search MNKTELIDHIASKADISKAAAGRSLDALIGAVKSTLKKGGTVTLVGFGTFAVSARAARTG RNPRTGESIKIKKAKVPKFRAGKALKDAVN NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgaacaaaactgaactgatcgaccacatcgccagcaaggccgatatctcgaaagccgcc gccggccgctccctcgatgcgctgatcggcgctgtgaagtcgacgctgaagaagggtggt acggtaacgctggtcggcttcggcacgttcgccgtttcggcccgtgctgcacgtacgggg cgcaatccgcgtacgggtgagagcatcaaaatcaaaaaggccaaggtaccgaagtttcgc gccggcaaggcactgaaggacgcggtcaactga

DBGET integrated database retrieval system