Bordetella genomosp. 13: CAL15_14835 Help Entry CAL15_14835       CDS       T05441                                  Name (GenBank) DNA-binding protein HU-beta   KO K03530   DNA-binding protein HU-beta Organism bgm  Bordetella genomosp. 13 Brite KEGG Orthology (KO) [BR:bgm00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:bgm03032]     CAL15_14835    03036 Chromosome and associated proteins [BR:bgm03036]     CAL15_14835    03400 DNA repair and recombination proteins [BR:bgm03400]     CAL15_14835 DNA replication proteins [BR:bgm03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     CAL15_14835 Chromosome and associated proteins [BR:bgm03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     CAL15_14835 DNA repair and recombination proteins [BR:bgm03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       CAL15_14835 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_1 2C_adapt Motif Other DBs NCBI-ProteinID:  ARP95548 UniProt:  A0A1W6ZDS7 LinkDB All DBs Position complement(3318000..3318272) Genome browser AA seq 90 aa AA seqDB search MNKTELIDHIASKADISKAAAGRSLDALIGAVKTTLKKGGTVTLVGFGTFAVSARAARTG RNPRTGETIKIKKAKVPKFRPGKALKDAVN NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgaataaaaccgaactcatcgatcacatcgccagcaaggctgacatctccaaggcggcc gccggccgttcgctggatgccctgatcggtgccgtcaagactacgttgaagaagggtggc acggtaacgctggtgggcttcggcacgttcgccgtgtcggcgcgcgctgcccgcacgggc cgcaatccgcgtaccggtgagaccatcaagatcaagaaggccaaggtgccgaagttccgt cccggcaaggccctgaaggacgccgtcaactga

DBGET integrated database retrieval system