Blautia hydrogenotrophica: BLHYD_10200 Help Entry BLHYD_10200       CDS       T09635                                  Name (GenBank) hypothetical protein   KO K00176   2-oxoglutarate ferredoxin oxidoreductase subunit delta [EC:1.2.7.3] Organism bhv  Blautia hydrogenotrophica Pathway bhv00020   Citrate cycle (TCA cycle) bhv00720   Other carbon fixation pathways bhv01100   Metabolic pathways bhv01110   Biosynthesis of secondary metabolites bhv01120   Microbial metabolism in diverse environments bhv01200   Carbon metabolism bhv01210   2-Oxocarboxylic acid metabolism Brite KEGG Orthology (KO) [BR:bhv00001]  09100 Metabolism   09101 Carbohydrate metabolism    00020 Citrate cycle (TCA cycle)     BLHYD_10200   09102 Energy metabolism    00720 Other carbon fixation pathways     BLHYD_10200 Enzymes [BR:bhv01000]  1. Oxidoreductases   1.2  Acting on the aldehyde or oxo group of donors    1.2.7  With an iron-sulfur protein as acceptor     1.2.7.3  2-oxoglutarate synthase      BLHYD_10200 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Fer4 Fer4_7 Fer4_2 Fer4_9 Fer4_10 Fer4_6 Fer4_4 Fer4_21 Fer4_16 Fer4_17 Fer4_3 TSCPD Fer4_13 Fer4_22 Fer4_8 Fer4_18 Spt5-NGN Phage_zn_bind_4 Motif Other DBs NCBI-ProteinID:  WPX83029 LinkDB All DBs Position 1071151..1071351 Genome browser AA seq 66 aa AA seqDB search MAVYIDQELCKSCKICINTCPKNVYAITHKVNKKGYNYVEAVREADCIACHKCEISCPDF VIHIEK NT seq 201 nt NT seq  +upstreamnt  +downstreamnt atggcagtatatatcgatcaggaattgtgcaaaagctgcaagatctgcatcaatacctgt cctaaaaatgtgtatgcgatcacacataaggtgaataagaaaggatataactacgtggag gctgtgcgggaagcagattgtattgcctgtcataagtgtgagatatcctgtccggatttt gttattcatatcgaaaaatag

DBGET integrated database retrieval system