Bubalus kerabau (carabao): 129643336 Help Entry 129643336         CDS       T11435                                  Symbol SOD1 Name (RefSeq) superoxide dismutase [Cu-Zn]   KO K04565   superoxide dismutase, Cu-Zn family [EC:1.15.1.1] Organism bke  Bubalus kerabau (carabao) Pathway bke04146   Peroxisome bke04213   Longevity regulating pathway - multiple species bke05012   Parkinson disease bke05014   Amyotrophic lateral sclerosis bke05016   Huntington disease bke05020   Prion disease bke05022   Pathways of neurodegeneration - multiple diseases bke05208   Chemical carcinogenesis - reactive oxygen species Brite KEGG Orthology (KO) [BR:bke00001]  09140 Cellular Processes   09141 Transport and catabolism    04146 Peroxisome     129643336 (SOD1)  09150 Organismal Systems   09149 Aging    04213 Longevity regulating pathway - multiple species     129643336 (SOD1)  09160 Human Diseases   09161 Cancer: overview    05208 Chemical carcinogenesis - reactive oxygen species     129643336 (SOD1)   09164 Neurodegenerative disease    05012 Parkinson disease     129643336 (SOD1)    05014 Amyotrophic lateral sclerosis     129643336 (SOD1)    05016 Huntington disease     129643336 (SOD1)    05020 Prion disease     129643336 (SOD1)    05022 Pathways of neurodegeneration - multiple diseases     129643336 (SOD1) Enzymes [BR:bke01000]  1. Oxidoreductases   1.15  Acting on superoxide as acceptor    1.15.1  Acting on superoxide as acceptor (only sub-subclass identified to date)     1.15.1.1  superoxide dismutase      129643336 (SOD1) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  129643336 NCBI-ProteinID:  XP_055423674 LinkDB All DBs Position 2:complement(50220453..50229196) Genome browser AA seq 152 aa AA seqDB search MATKAICVLKGDGPVQGTIHFEAKGNTVVVTGSITGLTEGDHGFHVHQFGDNTQGCTSAG PHFNPLSKKHGGPKDEERHVGDLGNVTADKNGVAVVDIVDSLISLSGEYSIIGRTMVVHE KPDDLGRGGNDESTKTGNAGSRLACGVIGIAK NT seq 459 nt NT seq  +upstreamnt  +downstreamnt atggcgacgaaggccatctgcgtgctgaagggcgacggcccggtgcaaggcaccatccac ttcgaggcaaagggaaatacagtcgtggtaactggatccattacaggattgaccgaaggt gatcatggattccacgtccatcagtttggagacaatacacaaggctgtaccagtgcaggt cctcactttaatcctctgtccaaaaaacacggtgggccaaaagatgaagagaggcatgtt ggagacctgggcaacgtgacggctgacaaaaacggtgttgccgtcgtggatattgtagat tctctgatctcactctcaggagaatattccatcattggccgcacgatggtggtccatgaa aaaccagatgacttgggcagaggtggaaatgacgaaagtacaaagactggaaacgctgga agtcgtttggcctgtggtgtaattggaattgccaagtaa

DBGET integrated database retrieval system