Bubalus kerabau (carabao): 129657276 Help Entry 129657276         CDS       T11435                                  Name (RefSeq) C-X-C motif chemokine 6   KO K05506   C-X-C motif chemokine 5/6 Organism bke  Bubalus kerabau (carabao) Pathway bke04060   Cytokine-cytokine receptor interaction bke04061   Viral protein interaction with cytokine and cytokine receptor bke04062   Chemokine signaling pathway bke04657   IL-17 signaling pathway bke04668   TNF signaling pathway bke05133   Pertussis bke05323   Rheumatoid arthritis Brite KEGG Orthology (KO) [BR:bke00001]  09130 Environmental Information Processing   09132 Signal transduction    04668 TNF signaling pathway     129657276   09133 Signaling molecules and interaction    04060 Cytokine-cytokine receptor interaction     129657276    04061 Viral protein interaction with cytokine and cytokine receptor     129657276  09150 Organismal Systems   09151 Immune system    04657 IL-17 signaling pathway     129657276    04062 Chemokine signaling pathway     129657276  09160 Human Diseases   09171 Infectious disease: bacterial    05133 Pertussis     129657276   09163 Immune disease    05323 Rheumatoid arthritis     129657276  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04052 Cytokines and neuropeptides [BR:bke04052]     129657276 Cytokines and neuropeptides [BR:bke04052]  Cytokines   Chemokines    129657276 SSDB OrthologParalogGFIT Motif Pfam:  IL8 Motif Other DBs NCBI-GeneID:  129657276 NCBI-ProteinID:  XP_055443466 LinkDB All DBs Position 7 Genome browser AA seq 112 aa AA seqDB search MRLLSSRAARVSGPSGSLCALLALLLLTPPGPLASAGPVAAVVRELRCVCLTTTPGIHPK TVSDLQVIAAGPQCSKVEVIATLKNGREVCLDPEAPLIKKIVQKILDSGKNN NT seq 339 nt NT seq  +upstreamnt  +downstreamnt atgagactactatccagccgcgccgcccgcgtctccggcccttcgggctccctgtgcgcg ctgctcgcgctgctgctgctgacgccgcccgggcccctcgccagcgccggtcctgtcgcg gccgttgtgagagagctgcgttgtgtgtgtttaaccaccacaccgggaattcatcccaaa acggtcagtgatctgcaggtgatcgccgcgggaccgcagtgctccaaggtggaagtgata gccaccttgaagaatggaagggaagtctgtctggacccagaagctcctttgatcaagaag atcgttcagaaaatattggacagtggaaagaacaattga

DBGET integrated database retrieval system