Bosea sp. NBC_00550: NWE53_00495 Help Entry NWE53_00495       CDS       T09927                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism bow  Bosea sp. NBC_00550 Brite KEGG Orthology (KO) [BR:bow00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:bow03032]     NWE53_00495    03036 Chromosome and associated proteins [BR:bow03036]     NWE53_00495    03400 DNA repair and recombination proteins [BR:bow03400]     NWE53_00495 DNA replication proteins [BR:bow03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     NWE53_00495 Chromosome and associated proteins [BR:bow03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     NWE53_00495 DNA repair and recombination proteins [BR:bow03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       NWE53_00495 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG Fervidolysin_NPro-like HU-CCDC81_bac_2 HU-CCDC81_euk_2 Motif Other DBs NCBI-ProteinID:  UZF92742 UniProt:  A0AAT9SX70 LinkDB All DBs Position complement(101019..101291) Genome browser AA seq 90 aa AA seqDB search MTKNELIAAIADETGKTKADVSAILASLGTTVAKTLKSGDDVTLGGIGKLSAAKREAREA RNPSTGATIKVPAKTVVKFKVTKDLADAVA NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgaccaagaatgaactgattgccgccatcgccgacgagaccggcaagaccaaggcggac gtttccgccatcctggcgtctctcggcacgaccgtcgccaagacgctgaagagcggcgac gacgtcacgctcggcggcatcggcaagctctccgccgccaagcgcgaagcccgcgaggcc cgcaacccctcgaccggcgcgaccatcaaggttcccgccaagaccgtcgtgaagttcaag gtcaccaaggaccttgccgacgcggtggcgtaa

DBGET integrated database retrieval system