Bacillus amyloliquefaciens LL3: LL3_01752 Help Entry LL3_01752         CDS       T01835                                  Symbol acpA Name (GenBank) Acyl carrier protein   KO K02078   acyl carrier protein Organism bql  Bacillus amyloliquefaciens LL3 Pathway bql00998   Biosynthesis of various antibiotics bql01100   Metabolic pathways bql01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bql00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     LL3_01752 (acpA)    00074 Mycolic acid biosynthesis     LL3_01752 (acpA)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     LL3_01752 (acpA) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  AEB63292 LinkDB All DBs Position 1627477..1627710 Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagatacattagagcgtgtaacgaaaatcatcgtagaccgccttggcgttgatgaa gctgacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggagatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system