Brachybacterium sp. NBEC-018: NLU66_11530 Help Entry NLU66_11530       CDS       T08499                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism brha  Brachybacterium sp. NBEC-018 Pathway brha00998   Biosynthesis of various antibiotics brha01100   Metabolic pathways brha01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:brha00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     NLU66_11530    00074 Mycolic acid biosynthesis     NLU66_11530   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     NLU66_11530 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF2117 Ribosomal_L50 Motif Other DBs NCBI-ProteinID:  UVY82860 LinkDB All DBs Position complement(2546980..2547228) Genome browser AA seq 82 aa AA seqDB search MASTENEILEGLAEIVNEETGVATEDVKLDKSFTDDLDIDSISMMTIVVNAEEKFDVRIP DEEVKNLVTVGDAVTYIAGAQS NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atggccagcaccgagaacgagatcctcgagggcctcgccgagatcgtcaacgaggagacc ggtgtcgccacggaggacgtcaagctcgacaagtccttcaccgacgacctcgacatcgac tccatctcgatgatgaccatcgtcgtcaacgccgaggagaagttcgacgtccgcatcccc gacgaagaggtcaagaacctcgtcaccgtcggcgacgccgtcacctacatcgcgggcgcc cagtcctga

DBGET integrated database retrieval system