Brachybacterium avium: CFK39_00900 Help Entry CFK39_00900       CDS       T04950                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism brv  Brachybacterium avium Pathway brv01100   Metabolic pathways brv01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:brv00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     CFK39_00900    00074 Mycolic acid biosynthesis     CFK39_00900   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     CFK39_00900 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Ribosomal_L50 Motif Other DBs NCBI-ProteinID:  ASK64640 UniProt:  A0A220U974 LinkDB All DBs Position 197809..198057 Genome browser AA seq 82 aa AA seqDB search MAHTENEILEGLAEIVNEETGVATEDVKLEKSFTDDLDIDSISMMTIVVNAEEKFDVRIP DEEVKNLATVGDAVKYIEGAQN NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atggcacacaccgagaacgagatcctcgagggcctcgccgagatcgtgaacgaggagacc ggtgtcgccaccgaggacgtcaagctcgagaagtccttcaccgacgacctcgacatcgac tccatctcgatgatgaccatcgtggtcaacgccgaggagaagttcgacgtccgcatcccc gacgaagaggtcaagaacctcgccaccgtcggcgacgccgtcaagtacatcgagggcgct cagaactga

DBGET integrated database retrieval system