Brachybacterium sp. P6-10-X1: BH708_03820 Help Entry BH708_03820       CDS       T04713                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism brx  Brachybacterium sp. P6-10-X1 Pathway brx01100   Metabolic pathways brx01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:brx00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     BH708_03820    00074 Mycolic acid biosynthesis     BH708_03820   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     BH708_03820 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Ribosomal_L50 Motif Other DBs NCBI-ProteinID:  APX31999 UniProt:  A0A1P8NCM6 LinkDB All DBs Position 856272..856520 Genome browser AA seq 82 aa AA seqDB search MAHTDNEILEGLAEIVNEETGVATEDVQLDKSFTDDLDIDSISMMTIVVNAEEKFDVRIP DEEVKNLATVGDAVKFITGAQS NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atggcacacaccgataacgagatcctcgagggcctcgccgagatcgtcaacgaggagacc ggtgtcgccacggaggacgtgcagctcgacaagtccttcaccgatgacctcgacatcgac tccatctccatgatgaccatcgtggtcaacgccgaggagaagttcgacgtccgcatcccc gacgaagaggtcaagaacctcgccaccgtcggcgacgccgtcaagttcatcacgggcgcc cagtcctga

DBGET integrated database retrieval system