Brachybacterium vulturis: CFK38_10480 Help Entry CFK38_10480       CDS       T05108                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism brz  Brachybacterium vulturis Pathway brz01100   Metabolic pathways brz01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:brz00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     CFK38_10480    00074 Mycolic acid biosynthesis     CFK38_10480   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     CFK38_10480 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Ribosomal_L50 Motif Other DBs NCBI-ProteinID:  ATG51895 UniProt:  A0A291GNT7 LinkDB All DBs Position complement(2332912..2333160) Genome browser AA seq 82 aa AA seqDB search MAHTENEILEGLAEIVNEETGVATEDVKLEKSFTDDLDIDSISMMTIVVNAEEKFDVRIP DEEVKNLATVGDAVKYIEGAQN NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atggcacacaccgagaacgagatcctcgagggcctcgccgagatcgtcaacgaggagacc ggtgtcgccaccgaggacgtcaagctcgagaagtccttcaccgacgacctcgacatcgac tccatctcgatgatgaccatcgtggtcaacgccgaggagaagttcgacgtccgcatcccc gacgaagaggtcaagaacctcgccaccgtcggcgacgccgtcaagtacatcgagggcgct cagaactga

DBGET integrated database retrieval system