Bacillus selenitireducens: Bsel_1711 Help Entry Bsel_1711         CDS       T01243                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bse  Bacillus selenitireducens Pathway bse01100   Metabolic pathways bse01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bse00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Bsel_1711    00074 Mycolic acid biosynthesis     Bsel_1711   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Bsel_1711 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Motif Other DBs NCBI-ProteinID:  ADH99219 UniProt:  D6XTT3 LinkDB All DBs Position 1910059..1910292 Genome browser AA seq 77 aa AA seqDB search MATVHERIAKIVSERLGVDESEVKKEATFKDDLGADSLDVVELVMELEDEFELEISDEDA EKIASVGDVIDYIERHQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggccacagtacatgaacgtattgcaaagatcgtctccgaacgtcttggtgtagatgag tccgaggtgaagaaagaagcaacatttaaagatgatctgggtgccgattcgcttgatgta gtcgagcttgttatggagcttgaagacgaattcgaactcgaaatctcagatgaagatgct gaaaagattgcatcagtcggtgacgtcattgattacatagaacgtcatcaataa

DBGET integrated database retrieval system