Bacillus subtilis BSn5: BSn5_20070 Help Entry BSn5_20070        CDS       T01417                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bsn  Bacillus subtilis BSn5 Pathway bsn00998   Biosynthesis of various antibiotics bsn01100   Metabolic pathways bsn01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bsn00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     BSn5_20070 (acpP)    00074 Mycolic acid biosynthesis     BSn5_20070 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     BSn5_20070 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  ADV96618 LinkDB All DBs Position 3875826..3876059 Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagacacattagagcgtgtaacgaaaatcatcgtagatcgccttggcgttgatgaa gcagacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggagatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system