Bacillus sonorensis: S101395_03140 Help Entry S101395_03140     CDS       T06571                                  Name (GenBank) Acyl carrier protein   KO K02078   acyl carrier protein Organism bson  Bacillus sonorensis Pathway bson00998   Biosynthesis of various antibiotics bson01100   Metabolic pathways bson01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bson00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     S101395_03140    00074 Mycolic acid biosynthesis     S101395_03140   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     S101395_03140 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Guanylate_cyc DUF1493 Motif Other DBs NCBI-ProteinID:  ASB89647 LinkDB All DBs Position complement(2949767..2950000) Genome browser AA seq 77 aa AA seqDB search MADALERVTKIIVDRLGVDEADVTLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYINSKQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagacgcattagagcgtgtaacaaaaatcatcgtagaccgccttggcgtagatgaa gctgacgtcactcttgaagcttcttttaaagaggatttaggcgctgattccctggatgta gttgagcttgtcatggaacttgaagacgagtttgatatggaaatttctgacgaagatgct gaaaagattgcaacagtcggtgacgctgtgaactacataaatagtaagcagtaa

DBGET integrated database retrieval system