Bacillus subtilis QB928: B657_15920 Help Entry B657_15920        CDS       T02292                                  Symbol acpA Name (GenBank) Acyl carrier protein   KO K02078   acyl carrier protein Organism bsq  Bacillus subtilis QB928 Pathway bsq00998   Biosynthesis of various antibiotics bsq01100   Metabolic pathways bsq01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bsq00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     B657_15920 (acpA)    00074 Mycolic acid biosynthesis     B657_15920 (acpA)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     B657_15920 (acpA) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  AFQ57528 LinkDB All DBs Position 1644836..1645069 Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagacacattagagcgtgtaacgaaaatcatcgtagatcgccttggcgttgatgaa gcagacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggagatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system