Bacillus stercoris: QI003_08560 Help Entry QI003_08560       CDS       T09305                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bstr  Bacillus stercoris Pathway bstr00998   Biosynthesis of various antibiotics bstr01100   Metabolic pathways bstr01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bstr00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     QI003_08560 (acpP)    00074 Mycolic acid biosynthesis     QI003_08560 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     QI003_08560 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  WGV97062 LinkDB All DBs Position 1672982..1673215 Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagatacattagagcgtgtaacgaaaatcatcgtagatcgccttggcgttgatgaa gcagacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggaaatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system