Bacillus stercoris: QI003_11985 Help Entry QI003_11985       CDS       T09305                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bstr  Bacillus stercoris Pathway bstr00998   Biosynthesis of various antibiotics bstr01100   Metabolic pathways bstr01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bstr00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     QI003_11985 (acpP)    00074 Mycolic acid biosynthesis     QI003_11985 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     QI003_11985 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  WGV97693 LinkDB All DBs Position 2385995..2386228 Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagatacattagagcgtgtaacgaaaatcatcgtagatcgccttggcgttgatgaa gcagacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggaaatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system