Bacillus subtilis subsp. subtilis JH642: BSUA_01723 Help Entry BSUA_01723        CDS       T03443                                  Symbol acpA Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bsul  Bacillus subtilis subsp. subtilis JH642 Pathway bsul00998   Biosynthesis of various antibiotics bsul01100   Metabolic pathways bsul01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bsul00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     BSUA_01723 (acpA)    00074 Mycolic acid biosynthesis     BSUA_01723 (acpA)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     BSUA_01723 (acpA) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  AIC40009 LinkDB All DBs Position 1648888..1649121 Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagacacattagagcgtgtaacgaaaatcatcgtagatcgccttggcgttgatgaa gcagacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggagatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system