Bacillus subtilis XF-1: C663_1636 Help Entry C663_1636         CDS       T02459                                  Symbol acpA Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bsx  Bacillus subtilis XF-1 Pathway bsx00998   Biosynthesis of various antibiotics bsx01100   Metabolic pathways bsx01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bsx00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     C663_1636 (acpA)    00074 Mycolic acid biosynthesis     C663_1636 (acpA)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     C663_1636 (acpA) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  AGE63438 LinkDB All DBs Position 1664578..1664811 Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagacacattagagcgtgtaacgaaaatcatcgtagatcgccttggcgttgatgaa gcagacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggagatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system