Bacillus subtilis subsp. subtilis BAB-1: I653_08185 Help Entry I653_08185        CDS       T02520                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bsy  Bacillus subtilis subsp. subtilis BAB-1 Pathway bsy00998   Biosynthesis of various antibiotics bsy01100   Metabolic pathways bsy01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bsy00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     I653_08185 (acpP)    00074 Mycolic acid biosynthesis     I653_08185 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     I653_08185 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  AGI28893 LinkDB All DBs Position 1624666..1624899 Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagacacattagagcgtgtaacgaaaatcatcgtagatcgccttggcgttgatgaa gcagacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggagatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system