Bos taurus (cow): 102465121 Help Entry 102465121         miRNA     T01008                                  Symbol MIR574 Name (RefSeq) bta-miR-574   KO K17123   microRNA 574 Organism bta  Bos taurus (cow) Brite KEGG Orthology (KO) [BR:bta00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:bta04147]     102465121 (MIR574)   09184 RNA family    03100 Non-coding RNAs [BR:bta03100]     102465121 (MIR574) Exosome [BR:bta04147]  Exosomal RNA   Exosomal RNA of haemopoietic cells    102465121 (MIR574)   Exosomal RNA of ovarian cancer cells    102465121 (MIR574) Non-coding RNAs [BR:bta03100]  Small non-coding RNA   Micro RNA    102465121 (MIR574) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  102465121 miRBase:  MI0021122 LinkDB All DBs Position 18:complement(62846574..62846640) Genome browser NT seq 24 nt NT seq  +upstreamnt  +downstreamnt tgagtgtgtgtgtgtgagtgtgtg

DBGET integrated database retrieval system