Bos taurus (cow): 790979 Help Entry 790979            miRNA     T01008                                  Symbol MIR16B Name (RefSeq) bta-miR-16b   KO K16988   microRNA 16 Organism bta  Bos taurus (cow) Pathway bta05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:bta00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     790979 (MIR16B)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:bta04147]     790979 (MIR16B)   09184 RNA family    03100 Non-coding RNAs [BR:bta03100]     790979 (MIR16B) Exosome [BR:bta04147]  Exosomal RNA   Exosomal RNA of breast milk    790979 (MIR16B)   Exosomal RNA of hepatic cancer cells    790979 (MIR16B)   Exosomal RNA of lung cancer cells    790979 (MIR16B)   Exosomal RNA of other cancer cells    790979 (MIR16B) Non-coding RNAs [BR:bta03100]  Other eukaryotic RNA   Micro RNA    790979 (MIR16B) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  790979 Ensembl:  ENSBTAG00000029916 miRBase:  MI0004739 LinkDB All DBs Position 1:complement(107073622..107073714) Genome browser NT seq 21 nt NT seq  +upstreamnt  +downstreamnt tagcagcacgtaaatattggc

DBGET integrated database retrieval system