Kyrpidia tusciae: Btus_1444 Help Entry Btus_1444         CDS       T01220                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bts  Kyrpidia tusciae Pathway bts01100   Metabolic pathways bts01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bts00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Btus_1444    00074 Mycolic acid biosynthesis     Btus_1444   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Btus_1444 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Ribosomal_L50 Motif Other DBs NCBI-ProteinID:  ADG06157 UniProt:  D5WP98 LinkDB All DBs Position 1457750..1457986 Genome browser AA seq 78 aa AA seqDB search MSDTFDRVKRIIVDRLGVDEDKVTMEASFKDDLGADSLDIVELVMELEDEFGMEISDEDA EKISTVAEVVQYIDSHQG NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atgtctgatacgttcgatcgcgtcaagcggattatcgtggaccgcctgggcgtcgatgaa gacaaagtgacgatggaagcgtcgtttaaagacgacctgggtgccgattccctcgacatt gtggaattggtcatggagttggaagacgaattcggcatggagatttccgatgaagatgcg gaaaagatttcgactgtggctgaagtggtccagtatattgattcgcatcaagggtaa

DBGET integrated database retrieval system