Bacillus weihaiensis: A9C19_11265 Help Entry A9C19_11265       CDS       T04822                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bwh  Bacillus weihaiensis Pathway bwh01100   Metabolic pathways bwh01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bwh00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     A9C19_11265    00074 Mycolic acid biosynthesis     A9C19_11265   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     A9C19_11265 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C Guanylate_cyc Motif Other DBs NCBI-ProteinID:  APH05288 UniProt:  A0A1L3MSG5 LinkDB All DBs Position complement(2380313..2380546) Genome browser AA seq 77 aa AA seqDB search MADVLERVTKIIVDRLGVDEAEVKFESSFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKIGTVGDAVNYINNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagatgttttagaacgtgtaacaaagattatcgtagaccgtttaggagtagatgag gcagaagtgaaatttgagtcttcatttaaagatgatcttggtgcagattccctagatgta gttgaactagttatggaacttgaagatgagttcgatatggaaatttctgatgaagatgca gaaaagatcggtacagtgggcgatgctgttaactacataaataatcagcaataa

DBGET integrated database retrieval system