Bacillus amyloliquefaciens XH7: BAXH7_01869 Help Entry BAXH7_01869       CDS       T01836                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism bxh  Bacillus amyloliquefaciens XH7 Pathway bxh00998   Biosynthesis of various antibiotics bxh01100   Metabolic pathways bxh01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bxh00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     BAXH7_01869 (acpP)    00074 Mycolic acid biosynthesis     BAXH7_01869 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     BAXH7_01869 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  AEK89001 LinkDB All DBs Position complement(1816365..1816598) Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagatacattagagcgtgtaacgaaaatcatcgtagaccgccttggcgttgatgaa gctgacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggagatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system