Bacillus velezensis YAU B9601-Y2: BANAU_1544 Help Entry BANAU_1544        CDS       T02050                                  Symbol acpP Name (GenBank) Acyl carrier protein ACP   KO K02078   acyl carrier protein Organism bya  Bacillus velezensis YAU B9601-Y2 Pathway bya00998   Biosynthesis of various antibiotics bya01100   Metabolic pathways bya01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:bya00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     BANAU_1544 (acpP)    00074 Mycolic acid biosynthesis     BANAU_1544 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     BANAU_1544 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  CCG49565 UniProt:  I2C518 LinkDB All DBs Position 1647326..1647559 Genome browser AA seq 77 aa AA seqDB search MADTLERVTKIIVDRLGVDEADVKLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAVNYIQNQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagatacattagagcgtgtaacgaaaatcatcgtagaccgccttggcgttgatgaa gctgacgtcaaacttgaagcttctttcaaggaagacttaggtgctgattccctagatgta gttgagcttgttatggaacttgaagacgagtttgatatggagatttctgacgaagatgct gaaaagattgcaacagtcggcgacgctgtgaactacatacaaaaccagcaataa

DBGET integrated database retrieval system