Catenulispora acidiphila: Caci_3548 Help Entry Caci_3548         CDS       T00967                                  Name (GenBank) phosphopantetheine-binding   KO K05553   minimal PKS acyl carrier protein Organism cai  Catenulispora acidiphila Pathway cai00253   Tetracycline biosynthesis cai01056   Biosynthesis of type II polyketide backbone cai01100   Metabolic pathways cai01110   Biosynthesis of secondary metabolites Module cai_M00778   Type II polyketide backbone biosynthesis, acyl-CoA + malonyl-CoA => polyketide Brite KEGG Orthology (KO) [BR:cai00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     Caci_3548    00253 Tetracycline biosynthesis     Caci_3548  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:cai01004]     Caci_3548    01008 Polyketide biosynthesis proteins [BR:cai01008]     Caci_3548 Lipid biosynthesis proteins [BR:cai01004]  Polyketide synthase   Component type    Caci_3548 Polyketide biosynthesis proteins [BR:cai01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      Caci_3548     Nonaketide PKS      Caci_3548     Decaketide PKS      Caci_3548 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  ACU72453 UniProt:  C7QAF4 LinkDB All DBs Position 3961840..3962118 Genome browser AA seq 92 aa AA seqDB search MSDTTLSEFTLEDLKRVLLAAAGAPDGAGLDGDILDLSFEDLGYDSIALLETVGHVERER GLSLEDSVVAEANTPRLFLEFVNGTVPVARAS NT seq 279 nt NT seq  +upstreamnt  +downstreamnt atgagtgacacgaccctgagcgagttcaccctcgaggacctcaagcgcgttctgctcgcc gccgccggcgcccccgacggcgccggtctggacggcgacatcctcgacctgagcttcgaa gacctcggctatgactccatcgcgctgctggagacggtcgggcacgtcgagcgcgagcgc ggcctgagcctggaggactcggtggtcgccgaggccaacacgccgcggctgttcctggag ttcgtcaacggcaccgtcccggtggcgcgcgccagctga

DBGET integrated database retrieval system