Catenulispora acidiphila: Caci_6487 Help Entry Caci_6487         CDS       T00967                                  Name (GenBank) phosphopantetheine-binding   KO K05553   minimal PKS acyl carrier protein Organism cai  Catenulispora acidiphila Pathway cai00253   Tetracycline biosynthesis cai01056   Biosynthesis of type II polyketide backbone cai01100   Metabolic pathways cai01110   Biosynthesis of secondary metabolites Module cai_M00778   Type II polyketide backbone biosynthesis, acyl-CoA + malonyl-CoA => polyketide Brite KEGG Orthology (KO) [BR:cai00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     Caci_6487    00253 Tetracycline biosynthesis     Caci_6487  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:cai01004]     Caci_6487    01008 Polyketide biosynthesis proteins [BR:cai01008]     Caci_6487 Lipid biosynthesis proteins [BR:cai01004]  Polyketide synthase   Component type    Caci_6487 Polyketide biosynthesis proteins [BR:cai01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      Caci_6487     Nonaketide PKS      Caci_6487     Decaketide PKS      Caci_6487 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Motif Other DBs NCBI-ProteinID:  ACU75337 UniProt:  C7PWQ7 LinkDB All DBs Position 7478573..7478881 Genome browser AA seq 102 aa AA seqDB search MTTHEMTLQELRDILLECAGAEEGIDLAGDIADRGFDELGYDSLALLEMAAKIEQTREVR IPDDAVSGLRTPRSVLDLVNSEAAAVPAVSAAAAAATPGADR NT seq 309 nt NT seq  +upstreamnt  +downstreamnt atgaccacacacgagatgaccttgcaggagctgcgcgacatcctgctggagtgcgccggc gccgaggaggggatcgacctggccggcgacatcgccgaccgcggcttcgacgagctcggc tacgactcgctggcgctgctggagatggcggccaagatcgagcagacccgcgaggtgagg atccccgacgacgcggtctccggcctgcgcaccccgcgctcggtcctggacctggtgaac agcgaggcggcagccgtgccggccgtgtcggccgcggcagccgcggcgactccgggggcg gaccggtga

DBGET integrated database retrieval system