Catenulispora acidiphila: Caci_6501 Help Entry Caci_6501         CDS       T00967                                  Name (GenBank) conserved hypothetical protein   KO K27095   acyl-CoA carboxylase epsilon subunit Organism cai  Catenulispora acidiphila Pathway cai00074   Mycolic acid biosynthesis cai00280   Valine, leucine and isoleucine degradation cai00630   Glyoxylate and dicarboxylate metabolism cai00640   Propanoate metabolism cai01100   Metabolic pathways cai01110   Biosynthesis of secondary metabolites cai01120   Microbial metabolism in diverse environments cai01200   Carbon metabolism Brite KEGG Orthology (KO) [BR:cai00001]  09100 Metabolism   09101 Carbohydrate metabolism    00630 Glyoxylate and dicarboxylate metabolism     Caci_6501    00640 Propanoate metabolism     Caci_6501   09103 Lipid metabolism    00074 Mycolic acid biosynthesis     Caci_6501   09105 Amino acid metabolism    00280 Valine, leucine and isoleucine degradation     Caci_6501 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  ACC_epsilon Motif Other DBs NCBI-ProteinID:  ACU75351 UniProt:  C7PY61 LinkDB All DBs Position complement(7492479..7492718) Genome browser AA seq 79 aa AA seqDB search MPGGHFTVLRGNPTPEELAAAVTVLLSLAATARTVVRPVSRTTRPHWHSRRRITHARGRH LPAAAWTGVGGGPWPGAGR NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atgcccgggggacacttcaccgtactgcgcggcaaccccaccccagaggaactggcggcg gcggtcacggtactgctgagcctggccgcgaccgcgcggacagttgtgcggccggtgtcg cgcacgacccgcccgcactggcactcgcggcggcggatcacccacgcgcgcggacggcat ctgccggcggcggcgtggaccggggtcggcggcgggccgtggccgggggccggtcggtga

DBGET integrated database retrieval system