Candidatus Chlorohelix allophototropha: OZ401_004562 Help Entry OZ401_004562      CDS       T09929                                  Name (GenBank) NrdH-redoxin   KO K18917   mycoredoxin [EC:1.20.4.3] Organism call  Candidatus Chlorohelix allophototropha Brite KEGG Orthology (KO) [BR:call00001]  09190 Not Included in Pathway or Brite   09191 Unclassified: metabolism    99980 Enzymes with EC numbers     OZ401_004562 Enzymes [BR:call01000]  1. Oxidoreductases   1.20  Acting on phosphorus or arsenic in donors    1.20.4  With disulfide as acceptor     1.20.4.3  mycoredoxin      OZ401_004562 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Glutaredoxin Thioredoxin_2 SR1P Thioredoxin GST_N_3 GST_N_2 Thioredoxin_9 Motif Other DBs NCBI-ProteinID:  WJW68940 LinkDB All DBs Position 2:2387288..2387551 Genome browser AA seq 87 aa AA seqDB search MANNSENNQIVMYGTTMCSDCRRTKQFFEANKVSYKWVDLANDPDAVEFVLKHNNGMQSV PTIIFPDGSIMVEPSNKELAEKLAVLV NT seq 264 nt NT seq  +upstreamnt  +downstreamnt ttggcaaacaactctgaaaataatcagatcgtaatgtacggtactactatgtgcagtgat tgccgtcgtaccaagcagttttttgaggctaataaggtttcttacaagtgggttgacctt gctaatgacccggatgcagttgagtttgtgctgaagcataacaacggtatgcaatccgta cccactatcattttccccgatggctcgataatggttgagccttccaataaagagttggca gaaaaattggcagtactggtttaa

DBGET integrated database retrieval system