Corynebacterium atypicum: CATYP_07680 Help Entry CATYP_07680       CDS       T03227                                  Name (GenBank) hypothetical protein   KO K02078   acyl carrier protein Organism cax  Corynebacterium atypicum Pathway cax01100   Metabolic pathways cax01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:cax00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     CATYP_07680    00074 Mycolic acid biosynthesis     CATYP_07680   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     CATYP_07680 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C Motif Other DBs NCBI-ProteinID:  AIG64484 UniProt:  A0ABN4DHS0 LinkDB All DBs Position 1689361..1689585 Genome browser AA seq 74 aa AA seqDB search MVADVLGCEPTEVHRHSRLRADLGADSLSVIELTVRAEEEFGVRLNDRTVLGFHTLGDAA DYLSKAQQKREDGE NT seq 225 nt NT seq  +upstreamnt  +downstreamnt ctggtcgccgacgtcctgggctgcgagcccaccgaggtgcaccggcacagccggctgcgc gccgacctgggcgcggactcgctcagcgtgatcgagttgacggttcgcgccgaggaggaa tttggggtgcgcctcaacgatcgcaccgtcctcgggtttcacacgcttggcgacgccgcc gactacttgagcaaggcgcaacaaaaacgcgaggacggtgagtaa

DBGET integrated database retrieval system