Serpentinimonas maccroryi: SMCB_0306 Help Entry SMCB_0306         CDS       T03627                                  Name (GenBank) phosphate-selective porin   KO K09892   cell division protein ZapB Organism cbab  Serpentinimonas maccroryi Brite KEGG Orthology (KO) [BR:cbab00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:cbab03036]     SMCB_0306 Chromosome and associated proteins [BR:cbab03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     SMCB_0306 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Crescentin PsbQ ZapB bZIP_Maf CCDC106 YabA Complex1_49kDa CCDC138_cc UPF0449 HALZ DUF2205 Motif Other DBs NCBI-ProteinID:  BAO82534 UniProt:  A0A060NUF2 LinkDB All DBs Position complement(342769..342987) Genome browser AA seq 72 aa AA seqDB search MPSQTPIDQISERVNRLLVRHEELLRANQLLQQQVEALRQERDLLRLQSQAVRQRLDALI EQLPTESDDSRP NT seq 219 nt NT seq  +upstreamnt  +downstreamnt atgccttcccagacccctatcgaccagatttccgagcgcgtcaaccgcttgctggtgcgc cacgaggaactgctgcgcgccaaccagttgttgcagcagcaagtcgaggcgctgcgccaa gagcgcgatttgttgcgcctgcaaagccaagccgtgcggcaacggctcgatgcgctgatc gagcaactgcccaccgagtcagacgacagccgcccatga

DBGET integrated database retrieval system